Ge dharmacon pgipz. sh Klf1: V3LMM_489109.

Ge dharmacon pgipz. Off-targets reduced by up to 90% Welcome to Vector Database! Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources. pGIPZ shRNAs against Hif1a (shRNA1, RHS4430-98513964; shRNA2, RHS4430-101518881), YAP (RHS4430-98525388), Myc (RHS4430-98853488), Scribbled (RHS4430-98901643) and a non-silencing control (NSC, RHS4348) clones are part of the pGIPZ human whole transcriptome shRNA library (GE Dharmacon) and were kindly provided by Dr. The Open Biosystems legacy includes vector-based gene modulation reagents that can provide powerful tools to study essential gene function. But, there’s more to Dharmacon than industry leading Constitutive pGIPZ or Dox-inducible pTRIPZ lentiviral vectors (Dharmacon/Horizon) were used for expression of shRNAs, see Suppl. It functions as a glyceraldehyde 3-phosphate dehydrogenase enzyme, which plays a role in the glycolytic pathway. The core function of Dharmacon products is to facilitate the manipulation and analysis of genetic material, such as nucleic acids and proteins, in a controlled and efficient manner. Through RNAi-mediated silencing of hundreds or thousands of genes in parallel, a pooled lentiviral shRNA screen can be performed to identify genes that regulate cellular responses and signaling pathways, or to discover novel gene functions. May 16, 2024 · JIMT-1 cells expressing control or HUNK shRNA were generated using the pGIPZ system (Thermo-GE/Dharmacon) and maintained in media containing 1 μg/mL puromycin as previously described. 1-shPTPN2 stable cell lines Murine PTPN2 shRNA (shPTPN2) was selected from the pGIPZ lentiviral shRNAmir library (GE Dharmacon). 2016 Aug 30;7:12632. pGIPZ-‐GAPDH, a positive control, which expresses an shRNA that targets both human, mouse, and rat GAPDH, with demonstrated effectiveness; and pGIPZ-‐NonSilencing, a negative control, which expresses an shRNA designed to not target any mammalian gene. pGIPZ shRNA was constructed by ligation of oligonucleotide targeting human ACSS2, KPNA1, or TFEB into the Xho I/Mlu I digested pGIPZ vector and TRIPZ human ACSS2 inducible shRNA was purchased from GE Dharmacon (Lafayette, CO). ZERO BIAS - scores, article reviews, protocol conditions and more Dharmacon™ siRNA, shRNA and microRNA solutions RNA interference (RNAi) remains the most simplest yet effective method for target gene knockdown in loss-of-function experiments. Sep 15, 2019 · When you need to knockout a gene next week, not next month Edit-R requires no cloning and is ready-to-use! The Edit-R CRISPR-Cas9 system allows you to very quickly complete your gene editing experiments by eliminating the time consuming process of cloning into an expression plasmid and subsequent sequencing to confirm proper insertion. The Mir-30-based hairpin sequence was removed and cloned into to the LMP vector (Openbio Systems). 1038/ncomms12632. The pGIPZ-shRBM47 expression vector was purchased from GE Dharmacon (V3LSH_393928). Dharmacon Inc. With our RNAi, gene expression and gene editing tools, you can gain a more complete view of what your genes of interest are doing. Stag2 inhibition Stag2 short hairpin RNA (shRNA) sequences were generated by cloning into the lentiviral pGIPZ vector (Open Biosystems/GE Dharmacon, Lafayette, Colorado, USA). We selected for cells with viral integration using puromycin. Also available from Dharmacon for use with Decode screening libraries are optimized primers and experimentally tested protocols for reliable identification of shRNA hits by high-throughput sequencing on an Illumina platform. Table 1. Recombinant human EGF (PeproTech) and PS341 (MedChemExpress) were purchased. Thanks a lot Andre. , 2008), since this version has been already extensively characterized (Lee et al. Techniques: Immunofluorescence, Transfection, Staining, shRNA, Plasmid Preparation STS26T (Nf1 +/− ) cell line was used to establish a stable Nf1 knockdown cell line using pGIPZ lentiviral Nf1 shRNA vector, Clone ID: V2LHS_76032 (Open BioSystems, GE Dharmacon, CO). The shRNA sequence utilized was 5’-TGCTGTTGACAGTGAGCGAGCACAAAGAAGTTACATCTTATAGTGAAGCCACAGATGTATAAGATGTAACTTCTTTGTGCCTGCCTACTGCCTCGGA-3’. Murine PTPN2 shRNA (shPTPN2) was selected from the pGIPZ lentiviral shRNAmir library (GE Dharmacon). pGIPZ non-silencing shRNA (CTTACTCTCGCCCAAGCGAGAG) were used as a control. The 5’ to 3’mature antisense sequence for Tyr -shRNA #1 is: TCTTCTGAAGGCATAGCCT, while that for Tyr -shRNA #2 is: GATCTGCTACAAATGATCT. gelifesciences. Establishment of YUMM1. The role of PKC β was also explored using a shRNA lentivirus (pGIPZ-PRKCB, 5579; GE Dharmacon, Lafayette, CO) to knockdown the expression. Our premium shRNA products use a microRNA-adapted shRNA design to promote more efficient cellular processing and reduce toxicity during RNAi experiments. 18 Why choose Dharmacon? Since its inception in 1995, Dharmacon’s expertise in bioinformatics, RNA biology, and synthetic chemistry enabled us to develop a complete line of products to study gene function. Each shRNA hairpin is cloned into the pGIPZ lentiviral vector and arrayed into 96-well plates to create a renewable RNAi resource. HH ligands, GLI1 and TRIB3 was performed by shRNAs cloned into the lentiviral vector pGIPZ (GE Dharmacon, Lafayette, CO, USA). . Steve Elledge of Harvard Medical School. PRODUCT DESCRIPTION The GIPZ lentiviral shRNAmir library was developed by Open Biosystems in collaboration with Dr. ヒトおよびマウス全ゲノムを網羅するshRNA コンストラクトをpGIPZレンチウイルスベクターに組み込むことによって構築されました。 Plasmid pGIPz-mPD-L1 from Dr. A non-silencing shRNAs (RHS4346, sh-; GE Dharmacon) was used as a control. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM2804 Feb 2, 2017 · The tdTomato gene was then subcloned into the EcoRI site downstream of the CMV promoter. This library combines the design advantages of microRNA-adapted shRNA with the pGIPZ lentiviral vector to create a powerful RNA tool capable of producing RNA interference (RNAi) in most Short hairpin RNA (shRNA) Dharmacon™ lentiviral shRNA reagents for long-term, inducible, and in vivo targeted gene silencing. Bioz Stars score, Techniques, Protocol Conditions and more for Rhs4346, supplied by GE Healthcare. , 2012) to initiate reprogramming. Perform specific and efficient, transient or long-term RNAi with GIPZ Lentiviral shRNA. Jan 9, 2017 · A lentiviral scrambled pGIPZ plasmid (GE Dharmacon) was used as control for transfection and virus packaging. These lentiviral shRNA vectors are identical to the vectors obtained from GE Dharmacon. Select a predesigned siRNA oligonucleotide or design your own custom siRNA with desired chemical modifications. Feb 16, 2017 · Lentiviral plasmid preparation and viral vector production Lentivirus-based RNAi transfer plasmids with pGIPZ shRunx1 (clone V2LHS_150257 and V3LHS_367631, GE Dharmacon) and pGIPZ non-silencing (Cat No. May 5, 2017 · We used dimVenus (Venus A208K, T145W) instead of sREACh, which has slightly better characteristics as FRET donor (Murakoshi et al. MEFs were infected with the lentiviruses for 8 h. Highlights All GIPZ shRNA constructs include the TurboGFP reporter Vector-based products for studying gene function. HiPurATM Plasmid DNA Maxiprep Purification Kit, used for pDNA isolation, was procured from HiMedia Laboratories Pvt. Whole genome shRNAmir lentiviral libraries have been created using both the GIPZTM lentiviral vector (Figure 4) that incorporates green fluorescent protein (GFP) to track shRNAmir expression, and the TRIPZTM lentiviral vector (Figure 5), which shares many of the benefits of GIPZ and includes a tetracycline (doxycycline) inducible promoter that produces tightly regulatable RNAi. Aug 1, 2017 · GE Dharmacon’s next-gen gene editing portfolio attracts UK firm. Cells were transiently transfected with each siRNA (50 nM) or miRNA (50 nM) using DharmaFECT (Thermo Scientific) and stably transfected with scrambled shRNA (pGIPZ-shCtr) and pGIPZ-shJAG1 using Trans-Lentiviral Packaging Kit (Thermo Scientific) according to the manufacturer's protocol. ZERO BIAS - scores, article reviews, protocol conditions and more Gene knock-down studies were done using pGIPZ lentiviruses (Dharmacon, GE Healthcare Life Sciences), which constitutively express the relevant shRNAmir (mircoRNA-adapted shRNA, hereafter referred to as shRNA) as listed in Table S5. All the lentiviruses were generated by the University of Michigan Vector Core. Lentivirus-based human RUNX1-specific shRNA clones in the pGIPZ construct backbone were purchased from Open Biosystems/GE Dharmacon. It contained the non-silencing control (NSC) RNA sequence 5′- AUCUCGCUUGGGCGAGAGUAAG −3′, in a 318-nt miR30 shRNA cassette. The tdTomato gene was then subcloned into the EcoRI site downstream of the CMV promoter. May 17, 2017 · We used dimVenus (Venus A208K, T145W) instead of sREACh, which has slightly better characteristics as FRET donor (Murakoshi et al. Positive and negative controls are a critical part of any gene silencing experiment as they enable accurate interpretation of knockdown results and provide confidence in the specificity of the response. The plasmid non-silencing pGIPZ shRNA miR control vector (pGIPZ-NSC) was purchased from GE Dharmacon (Cat. Sep 19, 2019 · For Ttc36, Peli1, and Stk33 knockdown, the shRNA pGIPZ vectors were purchased from GE Dharmacon (Lafayette, CO, USA), the target sequences were described in Supplementary Table 2. RHS4346, GE Dharmacon) were purchased from Thermo Scientific. May 5, 2017 · EZH2 and TRIM28 knockdowns were achieved using stable pGIPZ short-hairpin interfering RNA in lentivirus (clone: V2LHS_17507 for EZH2, clones of shTRIM28, Clone #1: V3LHS_358497, Clone #2: V3LHS_358502, GE Dharmacon, Lafayette, CO, USA). pGIPZ shRNA clones (Openbio Systems, GE Dharmacon) against Epor and Klf1 were obtained from a Baylor College of Medicine Core. Aug 24, 2022 · GSCs were infected overnight with concentrated pGIPZ lentivirus at a multiplicity of infection of 1. , now known as Dharmacon, was founded in 1995 by Stephen Scaringe as Dharmacon Research to develop and commercialize a new technology for RNA oligonucleotide synthesis. 1. Predesigned Accell siRNA is available as individual reagents and in SMARTpool format. For $85 Million Horizon Discovery Group plc (LSE: HZD), a global leader in the application of gene editing technologies, today announces that it has entered into an agreement to acquire Dharmacon from General Electric Company for a total consideration of $85 million (£65 million), subject to a working capital adjustment at Jan 11, 2018 · The Victorian Centre for Functional Genomics (VCFG) maintains a pGIPZ-shRNA-miR30 shRNA library as individual constructs in arrayed format to create boutique pooled libraries or work with individual genes. Jul 20, 2017 · Horizon Discovery Group has agreed to acquire GE Healthcare Dharmacon from parent General Electric for $85 million, creating a combined company focused on applying gene-editing and gene-modulation DharmaconTM Basic siRNA Resuspension This protocol is for the resuspension of synthetic siRNA Empty lentiviral vector for doxycycline-inducible expression of an shRNAmir together with TurboRFP. Steve Elledge (Harvard), offering access to genome wide RNAi resources. Ltd. Trans-Lentiviral shRNA Packaging System Package 2nd or 3rd generation viral vectors with high efficiency. Just provide the CRISPR Design Tool with a 20-base Dharmacon is a line of laboratory equipment produced by GE Healthcare. May 10, 2016 · For human reprogramming experiments, BJ fibroblasts were first infected with control or SUMO2 pGIPZ shRNA (V3LHS_388696 and V3LHS412780; GE Dharmacon) viruses. The shRNA sequence utilized was 5’-TGCTGTTGACAGTGAGC- GAGCACAAAGAAGTTACATCTTATAGTGAAGCCACAG ATGTATAAGATGTAACTTCTTTGTGCCTGCCTACTGCC TCGGA-3 ’. Product description The DharmaconTM GIPZTM Lentiviral shRNA Library was developed in collabora-tion with Dr. The trick is that pGIPZ uses miR30-based hairpins, while pLKO used "snapback" hairpins. y (TEM) were purchased from Electron Microscopy Sciences, PA, USA. We used dimVenus (Venus A208K, T145W) instead of sREACh, which has slightly better characteristics as FRET donor (Murakoshi et al. Transfection and cell-based assays Transfection with pGIPZ Non-Silencing Lentiviral #RHS4346, pGIPZ GAPDH Lentiviral #RHS4371, and human AKAP12 shRNAs (ID V3LHS_302165 mature antisense TCTTCTGTACGTACAAACT (Open Biosytems, GE Dharmacon, Lafayette, CO) was performed using Lipofectamine 2000 (Life Technologies, Grand Island, New York). UK-based gene-editing firm Horizon Discovery recently disclosed its agreement to acquire Dharmacon Inc. Available as pre-designed, genome-wide reagents for human, mouse and rat. Feb 28, 2017 · In this present study, we have generated silencing stable clones of HEK cells using six different pGIPZ (lentiviral vector) shRNAs targeted to human IGF-1R gene and a pGIPZ non-silencing shRNAmir Feb 5, 2021 · Information on acquisition, funding, investors, and executives for GE Healthcare Dharmacon. Jan 29, 2018 · EPC cells were nucleofected with the following plasmid constructs obtained from GE Dharmacon: human pGIPZ shVav2, clone V2LHS_171903; human pGIPZ shVav2, clone V2LHS_262378; human pGIPZ shRhoA, clone V2LHS_132703; human pGIPZ shScramble (control shRNA). TRIM28 knockdown was achieved using stable pGIPZ short-hairpin interfering RNA in lentivirus (clones of shTRIM28, Clone #1: V3LHS_358497, GE Dharmacon, Lafayette, CO, USA). Structured Review Revvity Signalsreagent pgipz non silencing shrna lentiviral control particles dharmacon ge life sciencesReagent Pgipz Non Silencing Shrna Lentiviral Control Particles Dharmacon Ge Life Sciences, supplied by Revvity Signals, used in various techniques. The following pGIPZ shR-NAs (GE Dharmacon, Chicago, IL) were used: control shRNA oligonucleotide, GCTTCTAACA- CCGGAGGTCTT; human STAT3 shRNA oligonu- GL261-Luc mouse GBM model and animal experiment in 100 μl PBS) or control PBS was injected intraperitoneal A lentiviral scrambled pGIPZ plasmid (GE Dharmacon) was used as control for transfection and virus packaging. As a stand-alone company, GE HealthCare is a leader in precision care, infusing innovation with patient-focused technologies to enable better care. b Replacement of tGFP coding sequence with shRNA-resistant cDNA Yeast Saccharomyces cerevisiae is a powerful model for understanding genetic regulation in eukaryotic cells. The GIPZ lentiviral shRNA collection was designed by and built in collaboration with Cold Spring Harbor Labs. Short hairpin RNA (shRNA) constructs were generated using pGreen-puro vector (System Biosciences, Mountain View, CA). Dharmacon pGIPZ plasmid DNA was obtained from GE Healthcare Life Sciences, India. a The backbone of pGIPZ vector used for lentiviral expression of shRNA. Knockdown of Yap expression was implemented with pGIPZ lentiviral shRNA vectors obtained from the University of Michigan Vector Core. (Mumbai, India), DNaseI, CutSmart® digestion buffer and restriction Jul 4, 2024 · The Cdc42 shRNA were inserted into the pGIPZ lentiviral vector with GFP (Clone-Id: V3LHS_641566 GE Dharmacon and Clone-Id: V2LHS_261933 GE Dharmacon). HeLa cells were transduced with 500-fold representation of the library at an multiplicity of infection (MOI) of 0. Use the PitchBook Platform to explore the full profile. For inducible knockdown of E2F1, shRNAmir insert from E2F1-targeting pGIPZ (Dharmacon, #V3LHS_393591) was cloned into pTRIPZ vector (Dharmacon) with MluI and XhoI to produce pTRIPZ -shE2F1. Ge Dharmacon, supplied by Revvity, used in various techniques. Patrick Paddison (Fred Pgipz Lentiviral Shrnamir Plasmids, supplied by Danaher Inc, used in various techniques. Aug 14, 2020 · The pGIPZ-based lentiviral shRNA for human Raptor (V3LHS_329849) or Rictor (V2THS_225915) and non-targeting (NT, RHS4346) were obtained from Open Biosystems/GE Dharmacon. Pgipz Gfp Non Silencing Control, supplied by Thermo Fisher, used in various techniques. Chanhee Kang (Seoul National University, Seoul, South Korea). Structured Review GE Healthcareplasmid non silencing pgipz shrna mir control vector pgipz nscPlasmid Non Silencing Pgipz Shrna Mir Control Vector Pgipz Nsc, supplied by GE Healthcare, used in various techniques. A novel siRNA for difficult-to-transfect cells, modified to require no transfection reagent or viral vector for delivery. This library combines the design advantages of microRNA-adapted shRNA (shRNAmir) with the pGIPZ lentiviral vector to create a powerful RNAi trigger capable of producing RNAi in most cell types including primary and non-dividing Mar 22, 2018 · Lentivirus particles were produced in HEK293T cells using the Trans-Lentiviral pGIPZ Packaging System (Open Biosystems - GE Dharmacon, TLP4615) according to the manufacturer’s protocol. Mien-Chie Hung's lab contains the insert PD-L1 and is published in Nat Commun. Lentivirus particles were produced in HEK293T cells using the Trans-Lentiviral pGIPZ Packaging System (Open Biosystems - GE Dharmacon, TLP4615) according to the manufacturer’s protocol. Mar 22, 2016 · Lentiviral shRNA pseudo-particles were produced by co-transfection of the Trans-Lentiviral packaging mix (GE Dharmacon) with shRNA transfer vector into HEK293T packaging cells. For MTHFD1 the following GE Dharmacon shRNA clones were used: V2LHS_216208 and V2LHS_196832. Jan 24, 2017 · Genetic inhibition of the HH ligands and GLI1 was performed by shRNAs cloned into the lentiviral vector pGIPZ (GE Dharmacon). To request a quote go to dharmacon. sh Klf1: V3LMM_489109. GIPZ positive and negative shRNA controls are available as E. GE purchased Dharmacon technology along with its HyClone cell culture and Sera-Mag magnetic bead lines from Thermo Fisher Scientific in 2014 for 提供 pGIPZ 载体/质粒图谱,全长序列,抗性,大小和元件信息。 ine 3000 reagent (ThermoFisher Scientiic) according to the man-ufacture’s instruction. Table2 for details. Dharmacon yeast resources include multiple collections for interrogating the yeast genome, including Tagged ORFs, Kockout Strains, Protein-Protein Interaction Collections and Mutant Strains and Screening Collections. Any investigator who purchases Dharmacon viral vector products is responsible for consulting with their institution’s health and biosafety group for specific guidelines on the handling of lentiviral vector particles. Jul 17, 2019 · Depth of coverage has been increased to have up to 10 shRNA designs per gene (including lncRNAs) for the human, mouse, and rat genomes using the newest Dharmacon shRNA design algorithm. For Rac2, shRNA sequence 5'-caaagggagagatgtggaa-3' (targeting 3’UTR) in pGIPZ lentiviral vector or empty pGIPZ vector (Dharmacon) as control (shCtrl2) were obtained from Einstein shRNA Core Facility. shRNA clones (GE Dharmacon pGIPZ): sh Epor: V3LMM_489985. M1-rMR TAT3-Gluc cells were transduced with the pGIPZ-PKC β -shRNA, and 3 days later, cells were serum-starved overnight and then incubated with vehicle or aldosterone (1 nM) for 6 hours, and the A negative control (scrambled) pGIPZ shRNAmir construct and five different pGIPZ shRNAmir constructs targeting the human LACE1 transcript (NM_145315) were obtained from Open Biosystems (GE Dharmacon). For control vector against pGIPZ- SIRT1, pGIPZ vector containing shRNA that targets firefly luciferase was kindly gifted from Prof. Article Snippet: Following non-silencing control was used: pGIPZ non-silencing lentiviral shRNA control (# RHS4348 GE Dharmacon). SnapGene Viewer is free software that allows molecular biologists to create, browse, and share richly annotated sequence files. Data for Rhs4346 gathered from related PubMed articles. HEK293T were transfected with HEPACAM ORF using the Precision LentiORF (pLOC) vector Lentiviral shRNA kinase library Decode Pooled Human GIPZ Kinase Library (GE Dharmacon RHS6078) was used to screen for telomere length regulators. Dharmacon RNA synthesis capabilities are well beyond the industry standard Long RNA oligos Custom RNA inhibitors for the study of microRNA biology Custom phosphoramidites Specialized chemical modifications or modified bases Larger scales for in vivo and preclinical development We offer many standard modifications such as 2’O methyl bases, pseudouridine (~U), Cy fluorescent dyes, black hole Aug 8, 2017 · Lentiviral shRNA kinase library Decode Pooled Human GIPZ Kinase Library (GE Dharmacon RHS6078) was used to screen for telomere length regulators. HeLa cells were transduced with 500-fold representation of the library at an MOI Knockdown of Rho GTPases was achieved through constitutive expression of shRNAs against RhoA and RhoC (lentiviral pGIPZ vectors were obtained from GE-Dharmacon). All shRNAs were expressed from a pGIPZ miRNA-based construct with TurboGFP from GE Dharmacon (Lafayette, Colorado). The pGIPZ-shRNA-miR30 vector has a turbo GFP reporter and puromycin selectable marker. PcDNA3. They have a wide range of Lentivirus vectors based on your needs. GE Dharmacon is a portfolio of laboratory equipment and tools used in various research and scientific applications. The lentiviral pGIPZ vector containing shRNA that targets human SIRT1 (clone No. Greg Hannon (CSHL) and Dr. pGIPZ shRNA clones (Open Biosystems, GE Dharmacon) against Epor or Klf1 were obtained from the Baylor College of Medicine Core. GIPZ Lentiviral shRNA targets human and mouse genes using multiple shRNA constructs that have been cloned into the pGIPZ lentiviral vector. 1 Flag-TFEB contained nonsense mutations of G959A, C960A, and A962G. Dec 4, 2014 · In October 2014, GE Healthcare Life Sciences launched Dharmacon Edit-R Gene Engineering System, its CRISPR-Cas9-based platform for creating permanent and heritable gene knockouts in cells in one-to-two weeks versus the previous one-month timescale. There are however several reported problems. After testing several shRNAs, the clone bearing the target sequence 5’AGAACTTCTTCACTACTCT3’ was chosen for subsequent experiments. coli glycerol stock clones or high-titer lentiviral particles. The PGIPZ is a lentiviral vector designed for inducible gene expression and knockdown in mammalian cells. Cells were transfected with 25 nM of a PD-L2 siRNA (GE Dharmacon, SMARTpool: siGENOME PDCD1LG2 siRNA and non-targeting control siRNA) as per the manufacturer’s protocol on day 2. Feb 1, 2018 · Transfection with pGIPZ Non-Silencing Lentiviral #RHS4346, pGIPZ GAPDH Lentiviral #RHS4371, and human AKAP12 shRNAs (ID V3LHS_302165 mature antisense TCTTCTGTACGTACAAACT (Open Biosytems, GE Dharmacon shRNA Selection Guide GE DharmaconTM Healthcare shRNA Selection Guide We ofer a selection of shRNA reagents and libraries. Constructs and cloning Lentiviral shRNA hairpins targeting BRD9 (RHS4430–200302441), SMARCE1 (RHS4430–200219172), and a non-silencing control (RHS4346) were constitutively expressed from the pGIPZ vector and obtained from GE Dharmacon; hairpins targeting GLTSCR1 were inducibly expressed from the pTRIPZ vector (#RHS4696) from GE Dharmacon. Hayashi (Okamoto et al. So did you use pGIPZ with the usual 2nd and 3rd generation LV packaging or did you use specific LV packaging system (Trans-Lentiviral shRNA Packaging Kit ) from Thermo scientific (GE/Dharmacon). Jun 30, 2017 · Decode Pooled Human GIPZ Kinase Library (GE Dharmacon RHS6078) was used to screen for telomere length regulators. , 2007 ). Constructs and infections of PLB-985 cells Retroviral approach The mCherry gene was amplified from pCDNA3. All other chemicals or general buffer reagents were purchased from Sigma-Aldrich unless specified. The following pGIPZ shR-NAs (GE Dharmacon, Chicago, IL) were used: control shRNA oligonucleotide, GCTTCTAACA- CCGGAGGTCTT; human STAT3 shRNA oligonu- GL261-Luc mouse GBM model and animal experiment in 100 μl PBS) or control PBS was injected intraperitoneal The siDESIGN Center is an advanced, user-friendly siRNA design tool, which significantly improves the likelihood of identifying functional siRNA. Experiments Structured Review GE Healthcareplasmid non silencing pgipz shrna mir control vector pgipz nscPlasmid Non Silencing Pgipz Shrna Mir Control Vector Pgipz Nsc, supplied by GE Healthcare, used in various techniques. shRNAs targeting APC (clone ID: TRCN0000010297 and TRCN0000040097, GE Dharmacon) or EBP (clone ID: V2LHS_250591 and V2LHS_197457, Open Biosystems) were in pLKO. , 2009). Nov 30, 2015 · The Tyr -shRNAs (Tyr -shRNA #1 and Tyr -shRNA #2) were purchased from Open Biosystems/GE Dharmacon (Lafayette, CO) in the pGIPZ plasmid. Lentiviral plasmid preparation and viral vector production Lentivirus-based RNAi transfer plasmids with pGIPZ shRunx1 (clone V2LHS_150257 and V3LHS_367631, GE Dharmacon) and pGIPZ non-silencing (Cat No. This vector is NOT available from Addgene and the database is no longer actively maintained. This product can be utilized for various analysis and quantification techniques. shRNA Cloning pGIPZ shRNA clones (Openbio Systems, GE Dharmacon) against Epor and Klf1 were obtained from a Baylor College of Medicine Core. During the current grant cycle MD Anderson provided $285,151 to purchase capital equipment and prior to 2012, provided funds to purchase FGC's libraries, including the pGIPZ shRNA library (human and mouse), human ORFeome Collaboration library, and Precision LentiORF library from GE Dharmacon and a human genome- wide pooled shRNA library from Article Snippet: The lentivirus backbone vector PGIPZ expressing p300 shRNA (V2LMN_102133 and V2LMN_90586) or non-silencing control shRNA was obtained from GE Dharmacon. The shPTPN2 plasmid was transfected using CordenPharma International and GE Healthcare’s Dharmacon business have entered a strategic collaboration to create an end-to-end solution for Feb 28, 2024 · Short hairpin RNA (shRNA) is a technique used to silence gene expression stably in various cells. The human GIPZ lentiviral shRNAmir library was developed by Open Biosystems in collaboration with Dr. 4. The empty vector was used as a control. On day 3, the selected groups were exposed to 100 IU/mL interferon gamma, and flow cytometry analyses were performed on day 4 as described above. M1-rMR TAT3-Gluc cells were transduced with the pGIPZ-PKC β -shRNA, and 3 days later, cells were serum-starved overnight and then incubated with vehicle or aldosterone (1 nM) for 6 hours, and the Oct 29, 2018 · Lentiviral shRNA kinase library Decode Pooled Human being GIPZ Kinase Library (GE Dharmacon RHS6078) was used to display for telomere size regulators. Dharmacon pGIPZ construct really work very well in cells and animals. This product provides a collection of pre-designed and validated siRNA sequences targeting various genes of interest. The aligned oligos were cloned into Nhe I-digested pGIPZ by sequence independent ligation cloning. Revvity’s Dharmacon reagents have pioneered the development of novel siRNA, shRNA, and microRNA technology for nearly 30 years, offering a broad portfolio of trusted synthetic and expressed reagents for highly Trusted Dharmacon solutions Well-known techniques that affect gene expression at the translational level, such as RNA interference and gene overexpression. First, the cloning of oligos can lead to ligation of multiple copies; second, premature termination of sequencing reaction Chalfont St. For human reprogramming experiments, BJ fibroblasts were first infected with control or SUMO2 pGIPZ shRNA (V3LHS_388696 and V3LHS412780; GE Dharmacon) viruses. shRNA against CaMKIIβ (Mus musculus) were purchased from GE-Dharmacon. For Ttc36, Peli1, and Stk33 knockdown, the shRNA pGIPZ vectors were purchased from GE Dharmacon (Lafayette, CO, USA), the target sequences were described in Supplementary Table 2. Dharmacon siRNA is algorithmically designed to be highly specific to the target gene with minimal off-target binding. The following clones were used for HEPACAM shRNA: V3LHS_413349, V3LHS_413351, and V3LHS_413352 versus control pGIPZ containing RFP (GE Dharmacon). Nov 25, 2017 · The pGIPZ lentiviral shRNA vectors (GE Dharmacon) targeting human TOP2A and TOP2B are provided in E. GAPDH (GTX100118) is a protein-based detection reagent used in molecular biology research. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM2804 Pgipz Non Silencing Shrna Lentiviral Particles Lentivirus Dharmacon Ge Lifesciences Rhs4348 Original, supplied by Danaher Inc, used in various techniques. May 2, 2017 · The role of PKC β was also explored using a shRNA lentivirus (pGIPZ-PRKCB, 5579; GE Dharmacon, Lafayette, CO) to knockdown the expression. One-of-a-kind options are available to enhance target specificity and adapt siRNA designs for more sophisticated experimental design. For overexpression of HA-PncA, pncA gene was amplified from E. The pTet-On advanced vector was purchased from Clontech (catalog number 631069). shRNA cloning. For PPAT knockdown, the pGIPz plasmids were obtained from Dharmacon, Lafayette, CO (GE Healthcare, USA). It contains a Tet-On 3G inducible promoter system and an optional puromycin resistance marker for selection of transduced cells. Decode lentiviral RNAi screening libraries are pools of Dharmacon™ GIPZ™ shRNAs. Open Biosystems began as an entrepreneurial start-up in the Hudson Alpha Institute of Biotechnology offering access to cDNA, ORF and shRNA products through academic partnerships. Visit our shRNA applications page to learn more. EPC cells were nucleofected with the following plasmid constructs obtained from GE Dharmacon: human pGIPZ shVav2, clone V2LHS_171903; human pGIPZ shVav2, clone V2LHS_262378; human pGIPZ shRhoA, clone V2LHS_132703; human pGIPZ shScramble (control shRNA). Mouse primary hepatocytes isolation and culture Primary hepatocytes were isolated from 8-week-old wild type and Ttc36−/− C57BL/6 mice. A streamlined sub-cloning procedure to transfer shRNA from a pSM2 vector to a pGIPZ lentiviral vector Sara Ansaloni, Nadav Lelkes, Jonathan Snyder, Charles Epstein, Aditi Dubey and Aleister J Saunders* SiRNAs (small interfering RNAs) are laboratory tools used to temporarily silence or knock down the expression of specific genes in cells. The number of colonies with and without (only DMSO) Y27632 supplementation was determined at day 10 post-transduction. ine 3000 reagent (ThermoFisher Scientiic) according to the man-ufacture’s instruction. Oct 10, 2020 · The following clones were used for MLC1 shRNA: V3LHS_320474, V3LHS_320475, V3LHS_320477, and V2LHS_87221 versus control pGIPZ containing RFP (GE Dharmacon). Jul 5, 2018 · CRP2 knockdown was achieved by pGIPZ lentiviral shRNAs (clone ID: V3LMM_417823 from GE Dharmacon, gene set RMM4532). We cloned the rtTA-Advanced cassette into the pIBX vector described previously using EcoRI and BamHI sites to make the pIBX-Tet-On vector (30). They function by binding to and degrading complementary mRNA molecules, preventing the translation of target genes. com or contact us at: [email protected]. Clones V2LHS_150256, V2LHS_150257, V2LHS_150259, V3LHS_367629, V3LHS_367631, and V3LHS_367633 were all screened for effectiveness in knocking down expression of RUNX1 in HBE and NCI-H292 (data not shown). This quick selection guide will help to determine the best option for your particular needs. The pGIPZ-based lentiviral shRNA for human Raptor (V3LHS_329849) or Rictor (V2THS_225915) and non-targeting (NT, RHS4346) were obtained from Open Biosystems/GE Dharmacon. Jun 25, 2025 · To generate the pGIPZ plasmids delivering the shRNA 1 and 2, two target sequences (Supplementary Figure S1) were selected using the shRNA design tool of Open Biosystems (GE Dharmacon), and oligo pairs containing the sequence were designed. Human epidermal growth factor receptor 2 (HER2)-targeted agents have proven to be effective, however, the development of resistance to these agents has become an obstacle in treating HER2+ breast cancer. Positively transduced cells were selected with puromycin Strategy for the construction of one-plasmid system. Choose from a variety of Dharmacon™ siRNA solutions Reliably silence gene function in any cell type RNA interference via synthetic small interfering RNA (siRNA) is the preferred choice for fast but reliable loss-of-function studies. TC10 shRNA was inserted into pSMART lentiviral vector with Turbo RFP. Steve Elledge (Harvard). SPARC houses both human and mouse pGIPZ lentiviral shRNAmir-GFP libraries developed by GE Dharmacon in collaboration with Dr. So I will need to remake the hairpins to move them into pLKO, but I"m hoping to use the same targetting The tdTomato gene was then subcloned into the EcoRI site downstream of the CMV promoter. Lentiviral packaging kits with calcium phosphate provide lower cost and higher-efficiency viral packaging along with premium biosafety. View the online User Guide for help using siDESIGN Center tool. Carbon/ formavar coated copper grids (200 mesh) used for Transmission Electron Microscopy (TEM) were purchased from Electron Microscopy Sciences, PA, USA. This library contained 4675 shRNAs, in pGIPZ lentiviral vectors, directed against 706 kinase and kinase related genes. Cells were transduced with the lentiviral particles followed by puromycin selection (2–5 μg/ml) for 10 days. pCMV-CaMKIIβ (Rattus) is from Dr. 1 vector and pGIPZ vector, respectively. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM_2804) were used to knock-down Camk2b. coli genomic DNA and cloned into a modified pcDNA3-HA plasmid using XhoI and NotI sites. Jul 18, 2016 · Colonies were counted 1 week later. doi: 10. Oct 16, 2021 · CDK4, hTERT (human telomerase reverse transcriptase), pSRZ-shTP53, and pBABE-hyg- KRASV12 were described previously (52). Expert siRNA design and guaranteed gene silencing provide a value-priced option for high quality RNAi results. , GE Healthcare’s Colorado-based gene editing tools unit for $85 million. Actually I need a couple of miRNAs Lentiviral constructs and was thinking to clone them in the pGIPZ vector. Jun 20, 2025 · The Cdc42 shRNA were inserted into the pGIPZ lentiviral vector with GFP (Clone-Id: V3LHS_641566 GE Dharmacon and Clone-Id: V2LHS_261933 GE Dharmacon). 1-mCherry, cloned at the 5′ end of the 5-LO cDNA and introduced in pMSCV-Puro. Stable Transduction Cell lines with stable Rho GDI silencing were engineered by viral transduction of a pGIPZ lentiviral plasmid containing a Rho GDI shRNA expression sequence (GE Dharmacon, Lafayette, CO) and control cells lines by transfection with an “empty” pGIPZ containing no shRNA expression sequence. V3LHS_389161; GE Dharmacon), was used for lentivirus production. Oct 5, 2023 · Regarding Raji cells transduced with the pGIPZ-IGF1R recombinant vector, the densitometric analysis revealed significantly reduced levels of IGF-1R (67%) and BCL2 (52%) proteins compared to Raji cells (non-transduced cells) and non-silencing (Ns) negative controls. Antibodies used in this study are listed in S2 Table. Two days later, cells were infected with the human pHAGE-STEMCCA virus (Sommer et al. Evidence implicates HUNK as an anti-cancer Feb 8, 2017 · The tdTomato gene was then subcloned into the EcoRI site downstream of the CMV promoter. Other shRNA sequences in pGIPZ (GE Dharmacon) targeting NOTCH3 (Notch3-A; V2LHS_229748 and Notch3-B; V2LHS_93017), ZEB1 (ZEB1-A; V2LHS_116663 and ZEB1-B; V2LHS_116659), and a non-silencing May 18, 2020 · TRIM28 knockdown was achieved using stable pGIPZ short-hairpin interfering RNA in lentivirus (clones of shTRIM28, Clone #1: V3LHS_358497, GE Dharmacon, Lafayette, CO, USA). Predesigned siGENOME siRNA are available as individual reagents and in SMARTpool format. coli as follows: TOP2A V3LHS_327878, TOP2B V2LHS_ 94084. For ALDH1L2, the following GE Dharmacon shRNA clones were used: V2LHS_30207, V2LHS_30209. Nov 5, 2018 · Lentiviral shRNA hairpins targeting BRD9 (RHS4430-200302441), SMARCE1 (RHS4430-200219172) and a non-silencing control (RHS4346) were constitutively expressed from the pGIPZ vector (GE Dharmacon At GE HealthCare, we see possibilities through innovation. Rab27a and SMPD2 KD were achieved using the pGIPZ lentiviral system (GE Dharmacon). This library combines the design advantages of microRNA-adapted shRNA (shRNAmir) with the pGIPZ lentiviral vector to create a powerful RNAi trigger capable of producing RNAi in most cell types including primary and non-dividing cells. #RHS4346). The following plasmids were used in these studies: pCMMP IRES-GFP (modified pCMMP-EnvA/RG-IRES-GFP from Callaway Lab, Salk Institute for Biological Studies); pCMMP SP5-IRES-GFP (modified pCMMP-EnvA/RG-IRES-GFP from Callaway Lab, Salk Institute for Biological Studies); pGIPZ shSP5-GFP #3 (GE Dharmacon, Clone ID: V3LHS_372625); pGIPZ shControl Jul 19, 2017 · Horizon Discovery Group Plc Acquires GE Healthcare Dharmacon, Inc. pGIPZ Camk2b shRNA (TCAGAGAGGAACTTCCCAG; V2LMM_2804 We have got several from Open Biosystems/ThermoFisher/GE Dharmacon to buy pre Designed shRNA plasmids. Bioz Stars score: 86/100, based on 1 PubMed citations. Giles, UK and Plankstadt, Germany - June 28, 2017 - CordenPharma International and GE Healthcare’s Dharmacon business have entered a strategic collaboration to create an end-to-end solution for oligonucleotide-based drug discovery. As part of our SMARTchoice suite of products, SMARTvector shRNAs give you an incredible amount of control over your knockdown experiments. It is designed for various applications in molecular biology and genomics research. Briefly, lentiviral particles were packaged in HEK293T cells (RRID:CVCL_0063) following calcium phosphate cotransfection of transfer vector, psPAX2 (Addgene, 12260), and pCMV-VSV-G (Addgene, 8454). May 17, 2017 · ). A lentiviral scrambled pGIPZ plasmid (GE Dharmacon) was used as control for transfection and virus packaging. 0. The GIPZ lentiviral shRNA system (GE Healthcare Dharmacon, Lafayette, CO, USA) contains the puromycin ‐resistant gene for selection of transduced cells and TurboGFP for monitoring the selection under the fluorescence microscope. EZH2 and TRIM28 knockdowns were achieved using stable pGIPZ short-hairpin interfering RNA in lentivirus (clone: V2LHS_17507 for EZH2, clones of shTRIM28, Clone #1: V3LHS_358497, Clone #2: V3LHS_358502, GE Dharmacon, Lafayette, CO, USA). A minimum of two independent shRNA were used for each gene; data are shown for one of them. GIPZ whole genome libraries for human or mouse, assembled using innovative bioinformatic tools to reflect the most up-to-date genetic and ontological information. The maps, notes, and annotations in the zip file on this page are copyrighted material. Knockdown your target gene function with confidence The patented modification pattern for specificity, combined with the SMARTselection algorithm for efficient, guaranteed target gene silencing, makes ON-TARGETplus siRNA the premium choice for optimal knockdown and reduced off-targets. The GFP with CMV promoter in pGIPZ plasmid was cut off from shRNA (shLDHA and Scramble) expression plasmids (GE Dharmacon) with Xbaǀ and NotI (New England Biolabs) and replaced by G-CSF fragment with CMV promoter using T4 DNA Ligase (New England Biolabs). Greg Hannon of Cold Spring Harbor Laboratory [CSHL] and Dr. ZERO BIAS - scores, article reviews, protocol conditions and more Aug 9, 2017 · Lentiviral particles were produced by transfection of HEK293 cells (by the calcium-phosphate method) with a pGIPZ lentiviral vector (GE Dharmacon) encoding either a non-silencing short hairpin RNA or SOCS3 short hairpin RNAs, along with the packaging vectors psPAX2 and pMD2. Following non-silencing control was used: pGIPZ non-silencing lentiviral shRNA control (# RHS4348 GE Dharmacon). Offered as glycerol stocks of shRNA clones arrayed in 96-well plates. The facility will construct individual lentiviral constructs from template cDNA in our set of lentiviral vectors or shRNA from our extensive on-site pGIPZ human and mouse shRNA libraries. The Dharmacon reagents portfolio encompass the broadest range of quality molecular biology tools for reliable and accurate gene function manipulation supporting gene-modulation (RNAi, (siRNA / shRNA / miRNA), CRISPR modulation, (CRISPRa / CRISPRi) and gene editing (CRISPRko, CRISPR knock-in, base editing). Nov 12, 2015 · All shRNAs were expressed from a pGIPZ miRNA-based construct with TurboGFP from GE Dharmacon (Lafayette, Colorado). This plasmid is available through Addgene. The following pGIPZ shRNAs (GE Dharmacon, Chicago, IL) were used: control shRNA oligonucleotide, GCTTCTAACACCGGAGGTCTT; human STAT3 shRNA oligonucleotide: TACCTAAGGCCATGAACTT; human PD-L1 shRNA oligonucleotide: TTGACTCCATCTTTCTTCA. Jun 4, 2024 · The Cdc42 shRNA were inserted into the pGIPZ lentiviral vector with GFP (Clone-Id: V3LHS_641566 GE Dharmacon and Clone-Id: V2LHS_261933 GE Dharmacon). Jan 16, 2024 · The lentiviral pGIPZ vector containing shRNA that targets human SIRT1 (clone No. The core function of GE Dharmacon products is to provide researchers with high-quality instrumentation and reagents for gene expression analysis, genetic manipulation, and related scientific investigations. mtp wpsnjt dfsme dl0 zxib u5 1gcjhha lq9sj7 isskw 2e